Tuesday, August 5, 2014

Human Variation and Race Blog

1. High altitude.

2. Four ways humans have adapted to high altitude:

- being born or growing up in a place where there is high altitude



- exercising in levels of high altitude and also maintaining a healthy lifestyle definitely helps out with adapting.



- developing a strong heart and strong lungs are important in places with high altitudes.



- visiting places with high altitudes prepares physically and mentally.



3. The benefit of studying human variation from this perspective across environmental clines is that we obtain more information based on evidence that can back up our theories as oppose to other opinions. Yes, this information helps understand what exactly causes these stresses so problems can be prevented.

4. I think race could have some input in what I listed on #2 but only up to a certain point. Every race is different which mean how and if they adapt is also different. Environmental influences however could provide a better explanation of the affects of the environments humans live in than the races of humans.

Tuesday, July 29, 2014

Language Blog

Part 1: Engaging in a conversation for 15 minutes without using any version of  symbolic language (no speaking, writing or ASL).

I found this experiment very difficult at first. I am so use to being able to speak and of course accompanying my words with hand gestures so not being able to do that even for just 15 minutes, I felt a little helpless and not myself. I really didn't know why to do at first or how to communicate, so I just listened. I engaged in the conversation by hearing what everyone else had to say, hoping no remarks or questions were directed towards me. 

The other partners engaged in the conversation didn't notice at first, since all I was doing was listening. However after a while had passed, my silence was getting pretty loud and they began asking questions. I already knew I couldn't speak and was trying very hard to not gesture my hands, so i resulted in simple head nods and shoulder shrugs. They looked at me like I was a little off but of course knew something was up. After cracking some jokes in an attempt to break my silence, they eventually carried on with the conversation, making it easier for me to just sit back and listen.

If my parters and I represented two different cultures meeting for the first time, their culture would have the advantage in communicating complex ideas. Not only would they be able to use speech in an attempt to understand us and vise verse, but they would also have sign language or writing or any other symbolic communication tactic. This advantage would most likely lead them to having attitudes towards us making them feel like they are superior because they have more forms of communication then the other culture.

People in our culture who are unable to speak or hear I believe have more difficulties than those who can. This can affect them because those who are able to speak and communicate easily can sometimes find it frustrating when they are trying to get a message across. Of course for them its easy because they simple say what needs to be said, but they don't always consider how difficult it can be for the other individual.

Part 2: Spend 15 minutes communicating without any physical embellishments, i.e., no hand signals, vocal initiation, head, facial or body movements.

For this experiment, I was able to get through 15 minutes of conversation with just my words and no physical embellishments. Even though this part of the experiment was easier than the first, it was definitely more frustrating. I was constantly having to hold my hands back because it was just in my nature to use them during conversation, especially when sharing a story or experience. 

My partners in the conversation weren't so much affected by at as in Part 1. As long as they were able to communicate verbally with me, nothing else really mattered. I found it more difficult because I knew I wasn't allowed to use gestures, which made me want to us them even more!

This experiment showed the importance in using "signs" and other non-speech language techniques when communicating with others. Although it may not seem so important, these techniques help elaborate our communication. They help determine how important or exaggerated a conversation needs to be.

I do think there are few people who have difficulty reading body language, meanwhile for others it's like a second language. When you're able to read body language, you can catch on to many things, like mood, attitude and other feelings and emotions some express without using words. I think its impossible to find an environment where body language isn't used. It's used with everyone and everywhere. Even when you don't realize it, you're using body language for the littlest things.

Tuesday, July 15, 2014

The Piltdown Hoax

The Piltdown Hoax was based on an archeological site in England during the early 1900s where archeologist Charles Dawson claimed he discovered parts of a human, ape and other mammal fossils. Together he and a group of experts including English geologist Arthur Smith Woodward, French paleontologist Father Pierre Teilhard de Chardin and English anatomist Arthur Keith discovered what would be recognized as the Piltdown Man. Supposedly, all those parts that were found had belonged to a single human being, however it wasn't until about 50 years later that the Piltdown man was found to be nothing but a false discovery, hence the new given name, the Piltdown Hoax.

All humans have faults, it is in our nature, purposely or accidental. Self interest, fame and dishonesty were some faults found in this situation. Dawson wanted so badly to be notoriously recognized for his discovery and to be accepted by the scientific community that he went to great lengths to create this false finding. Although he had some good intentions, like having some discoveries his country could take pride in, it was not the right way to go about accomplishing them.

The Piltdown Hoax would've never been brought to light had it not been for new scientific technologies like fluorine testing and microscopes. This helped scientists greatly in finding a correct timeline for the fossils.

I don't think its possible to completely remove human factors from science because we'd still need human input to help determine things that a computer cannot. Machines don't have the passion or drive to affect there work and that is what makes for a great discovery.

The lesson learned here is to never believe every single thing you hear, even if there is supposed evidence. Anything can be fabricated or planted. We will never really know what is fake or what is real. The only reliable source that can help verify a claim is scientific proof and even that can sometimes be doubted. One must always have a solid argument to back up their claims.





Wednesday, July 9, 2014

Comparative Primates

Dentition Patterns in Primates

1. Lemurs (Prosimians/Strepsirhini)
  • a. They are native to the Madagascar. Most Lemurs are arboreal, living in trees; they spend most of their time at the top of the rain forest canopy or in the forest mid level.

  • b. Their dentition is heterodent, which means multiple tooth morphologies. Their dental formula is Upper: 2.1.3.3, lower: 2.1.3.3. Their dentition pattern is 2 incisors, 1 canine, 3 premolars, and 3 premolars. 
  • Prosimians have a tooth-comb; which is six of their teeth that are closely pushed together. Leaf eating Lemurs have a little tooth-comb. The fruit eating Lemurs use their tooth-comb to pick out seeds from the fruit.


2. Spider Monkeys (New World Monkey/Platyrrhini)

  • a. Spider Monkeys are form the South America and Central America; like Lemurs, Spider Monkeys are also arboreal. They spend most of their time in the upper canopy of the rain forest.
  • b. The Spider Monkeys dental formula is Upper: 2.1.3.3, lower: 2.1.3.3. Their dentition pattern is 2 incisors, 1 canine, 3 premolars, and 3 premolars. 

  • c. Spider Monkeys are fruit eaters; they use their incisors to pick fruits off of the trees.


3. Baboons (Old World Monkey/Cercopithecidae)
  • a. Baboons are found in Ethiopia, Saudi Arabia, and Yemen.The have shown us that they can survive almost everywhere, such as the savanna and other semi-arid habitats, and tropical forests.
  • b. Baboons dental formula is Upper: 2.1.2.3, lower: 2.1.2.3. They have 2 incisors, 1 canine, 2 premolars, and 3 molars.  
  • c. Baboons eat grass, leaves, and sometimes eat fish, and other small animal. The trait can be viewed as an adaption because it allows the dentition to be omnivorous.


4. Gibbon (Lesser ape/Hylobatidae)
  • a. Gibbons are found in southeast Asia, and parts of southern China. They live in a tropical and subtropical rain forests.
  • b. Their dental formula is Upper: 2.1.2.3, lower: 2.1.2.3; they have 2 incisors, 1 canine, 2 premolars, and 3 molars.
  • c. Gibbons, mostly eat fruit, which is every where in their environment. You can believe that their teeth have adapted to their environment in order to eat their food.


5. Chimpanzee (Great ape/Hominidae)
  • a. Chimpanzee's can be found in Africa; they live in rain forests and savanna's 
  • b. Their dental formula is the same as Gibbons, and Baboons, which is Upper: 2.1.2.3, lower: 2.1.2.3. They have 2 incisors, 1 canine, 2 premolars, and 3 molars.

  • c. The Chimpanzee's diet ranges from plants and small animals, which means that their teeth have adapted to the need of eating anything.


Conclusion
  • Studying these primates dentition patterns, the environment and the type of food make an impact on the primates dental structure. Spider Monkeys and Lemurs have the same dental formula 2133, which means they are new world monkeys. They live in a similar environment and eat similar foods. The last three, Baboons, Gibbons, and Chimpanzee have the same dental formula (2123) which makes them old world monkeys. The three primates share a similar environment and food. This makes the environment and the food type important to the dental structure.

Thursday, July 3, 2014

Analogy & Homology

Homologous Species: The Cat and The Bat

a.  Bats and cats are two different species with homologous traits.

b. A bat’s wing in comparison to a cat’s leg is similar because of their skeletal components. Both structures have a humerus, radius, ulna, carpals, metacarpals and phalanges. However, even though they have homologous traits, they are each structured function differently. A bat’s skeletal structure has much longer metacarpals and phalanges then that of a cat, which helps spread their wings in order to fly. A cat doesn’t have wings therefor does not need to fly. Their bones appear a lot thicker and close together, which is helpful because they need that strength to support themselves while they walk and jump from place to place. So even though these two species contain homologous traits, their structures are completely different because they both have different uses for these traits.

c. Even though the bat and the cat have homologous traits, they don’t necessarily have the exact same ancestor. They do however come from the same structures within the embryo. So this would conclude that because they have homologous structures, they come from a common ancestor.

d. 



Analogous Species: The Shark and The Dolphin


 a. The penguin and the dolphin are two analogous species. Both have fins and a body structure that look very similar.

b. Although dolphins are mammals and sharks are fish, both have a torpedo shaped body and dorsal fins that are caused by convergent evolution. They both need their fins in order to maintain balance while swimming.

c. There hasn’t been any recent discovery on a common ancestor for the dolphin and shark. I feel that hypothetically, if they did have a common ancestor, it would have had some sort of fin structure. Both organisms have fins so it’s a great possibility that whatever they both trace back too also had a similar structure.


d. 

Thursday, June 26, 2014

DNA STRAND

GAGTCAAGGGAACGGTAGTGTGATAACCCTGGTTAGCCATATCCATG

Thursday, June 19, 2014

Historical Influences on Darwin

1. Alfred Russel Wallace was one of the many who influenced and contributed to Darwin's development of the theory on natural selection with his own theory of Evolution due to natural selection.

2. Wallace, apart from being the cofounder of natural selection, was also known as the "Father of Biogeography" because of his contributions to the development of evolutionary theory. He came up with the concept of warning coloration in animals, as well as the Wallace effect, an explanation on how natural selection contributes to speciation by encouraging the development of barriers against hybridization.

3. Although they both developed theories of evolution which dealt with change over time, Wallace and Darwin contrasted greatly. Wallace's theory limited the power of natural selection on biological change, while Darwin's theory explains that all biological change can be explained through "survival of the fittest".

4. I think that without Wallace's impact, Darwin still could have developed his own theory. However I don't think it would've have been as strong and thorough without some influence that would inspire him to dig deeper on the subject.

5. Darwins publication of Origin of the Species caused great controversy with the church. While many opposed it, some that it was work of God.



https://www.princeton.edu/~achaney/tmve/wiki100k/docs/Alfred_Russel_Wallace.html

http://www.alfredwallace.org/intelligent-evolution.php