Thursday, June 26, 2014

DNA STRAND

GAGTCAAGGGAACGGTAGTGTGATAACCCTGGTTAGCCATATCCATG

Thursday, June 19, 2014

Historical Influences on Darwin

1. Alfred Russel Wallace was one of the many who influenced and contributed to Darwin's development of the theory on natural selection with his own theory of Evolution due to natural selection.

2. Wallace, apart from being the cofounder of natural selection, was also known as the "Father of Biogeography" because of his contributions to the development of evolutionary theory. He came up with the concept of warning coloration in animals, as well as the Wallace effect, an explanation on how natural selection contributes to speciation by encouraging the development of barriers against hybridization.

3. Although they both developed theories of evolution which dealt with change over time, Wallace and Darwin contrasted greatly. Wallace's theory limited the power of natural selection on biological change, while Darwin's theory explains that all biological change can be explained through "survival of the fittest".

4. I think that without Wallace's impact, Darwin still could have developed his own theory. However I don't think it would've have been as strong and thorough without some influence that would inspire him to dig deeper on the subject.

5. Darwins publication of Origin of the Species caused great controversy with the church. While many opposed it, some that it was work of God.



https://www.princeton.edu/~achaney/tmve/wiki100k/docs/Alfred_Russel_Wallace.html

http://www.alfredwallace.org/intelligent-evolution.php